{"id":240,"date":"2021-07-08T15:10:58","date_gmt":"2021-07-08T08:10:58","guid":{"rendered":"http:\/\/dnape.online\/?p=240"},"modified":"2023-07-14T13:58:23","modified_gmt":"2023-07-14T06:58:23","slug":"re-pcr","status":"publish","type":"post","link":"https:\/\/dnape.online\/en\/2021\/07\/re-pcr\/","title":{"rendered":"Cutting out the amplicon with restriction endonuclease \u2013 a way to exclude the false results of RT PCR with TaqMan probe"},"content":{"rendered":"\n<\/span>

[vc_row css=”.vc_custom_1576496196814{background-color: #ededed !important;}”][vc_column width=”2\/3″][vc_column_text]<\/p>\n

A.G. Akishev1<\/sup>, N.A.Netesova2<\/sup>, M.A. Abdurashitov1<\/sup>, S.Kh. Degtyarev1<\/sup><\/strong><\/p>\n

1<\/sup> SibEnzyme, Novosibirsk
\n2<\/sup> Epigenlab, Novosibirsk<\/p>\n

* corresponding author: Alexander Akishev, SibEnzyme, 2\/12 Ak.Timakov Str., Novosibirsk 630117, Russia; Tel: +7 383 3334991; Fax: +7 383 3336853; E-mail: aki@sibenzyme.ru<\/a><\/p>\n

\n

Real-time PCR with TaqMan probe (RT PCR) is one of the main methods for analyzing the structure of human DNA and is widely used in medicine. In this work, PCR RT of 4 fragments of human genomic DNA (chr1: 90717178-90717300, chr9: 97464604-97464756, chr11: 65647215-65647307, chr17: 4560027-4560175) was performed with DNA preparations from human blood obtained both by the standard method of phenol deproteinization and isolated on columns. Preparations of the original DNA and DNA after a treatment with a restriction endonuclease that cuts out the amplified fragment were used in PCR. In the case of native DNA preparations purified by column, PCR of 3 from 4 DNA fragments provided overestimated Cq values. In the case of the phenol purification, overestimated Cq values for native DNA preparations were obtained for 2 from 4 DNA fragments. For DNA preparations obtained by the column purification, treatment of DNA with a restriction endonuclease that cuts out the amplified fragment leads to normal Cq values for all four analyzed DNA fragments. Thus, RT PCR of native DNA obtained by the column purification may result in an overestimation of Cq, which is avoided if DNA previously has been hydrolyzed by a restriction endonuclease that cuts out the amplicon.<\/p>\n<\/div>\n

[\/vc_column_text][\/vc_column][vc_column width=”1\/3″][vc_column_text]Key words<\/strong>: restriction endonucleses, DNA preparations from human blood, RT PCR<\/p>\n

DOI:<\/strong> 10.26213\/SE.2021.45.29.001<\/a><\/p>\n

Citation:<\/strong><\/p>\n

Akishev A.G., Netesova N.A., Abdurashitov M.A., Degtyarev S.Kh. (2021) Cutting out the amplicon with restriction endonuclease \u2013 a way to exclude the false results of RT PCR with TaqMan probe, DNA processing enzymes, vol 2021(1), DOI: 10.26213\/SE.2021.45.29.001<\/a><\/p>\n

This work is available at Creative Commons licence \u00abAttribution-NonCommercial\u00bb 4.0 International<\/a>.<\/p>\n

Full-text-pdf<\/a>[\/vc_column_text][\/vc_column][\/vc_row][vc_row][vc_column][vc_column_text]<\/p>\n

INTRODUCTION<\/h2>\n

Real-time PCR with TaqMan probe (RT PCR) is widely used in the analysis of the human DNA structure and is one of the main diagnostic methods in medicine. Earlier, we showed that a preliminary hydrolysis of DNA with restriction endonuclease that cuts out the amplified fragment allows to conduct comparative PCR studies of many DNA preparations [1-4]. In this work, we performed RT PCR study of 4 fragments of human genome in DNA preparations from human blood obtained both by the standard method of phenol deproteinization and purified by the column. PCR was performed both on the original DNA and after its hydrolysis with restriction endonuclease which cuts out the amplified fragment.<\/p>\n

MATERIALS AND METHODS<\/h2>\n

Materials.<\/strong> Phenol (JSC \u201cReactiv\u201d, Novosibirsk), chloroform (JSC \u201cReactiv\u201d, Novosibirsk), isoamyl alcohol (JSC \u201cReactiv\u201d, Novosibirsk), RNAse A (LLC \u201cSamson-Med\u201d, St. Petersburg), SDS (LLC \u201cHelicon\u201d, Moscow) were used in the work. \u201cPCR kit with DNA pretreatment\u201d, \u201ckit for DNA purification from a light fraction of the blood cells\u201d, oligonucleotides, Bst2UI, HinfI, MspI restriction endonucleases, bidistilled water and buffer solutions produced by SibEnzyme Ltd.<\/p>\n

The material for the study<\/strong> was DNA samples isolated from blood cells of 16 donors. DNA preparations of 8 donors under the numbers 205, 1086, 1087, 1137, 1151, 1205, 1437 and 1487 were obtained by the phenol-chloroform method as described earlier [5] with some modifications. The obtained DNA preparations were treated only with RNase A without an addition of TaqI restriction endonuclease. In the case of other 8 donors under the numbers 232, 235, 582, 558, 559, 604, 605 and 640 DNA was isolated from a light fraction of the blood cells as described earlier [4]. The concentration of the obtained DNA preparations was determined by spectrophotometer.<\/p>\n

The restriction mixture was prepared according to the protocol<\/strong> [6]. 250 \u00b5l of the restriction mixture from \u201cPCR Kit with DNA pretreatment\u201d were mixed with 1 \u00b5l (20 units) of HinfI restriction endonuclease (mixture A) for hydrolysis of DNA fragment 9-604. 250 \u00b5l of the restriction mixture from \u201cPCR Kit with DNA pretreatment\u201d were mixed with 1 \u00b5l (20 units) of Bst2UI restriction endonuclease (mixture B) for hydrolysis of DNA fragment 1-178. 250 \u00b5l of the restriction mixture from of \u201cPCR Kit with DNA pretreatment\u201d were mixed with 1 \u00b5l (20 units) of MspI restriction endonuclease (mixture C) for hydrolysis of DNA fragment 17-027 and 11-215.<\/p>\n

Preparation of a PCR mixture<\/strong>. 77 \u00b5l of a mixture of primers and a probe (10 \u00b5M each) specific to the studied DNA fragment and 12.8 \u00b5l of Hot Start Taq DNA polymerase (5 units of act\/\u00b5l) were added to 940 \u00b5l of the PCR-mix from \u201cPCR Kit with DNA pretreatment\u201d and mixed.<\/p>\n

Hydrolysis of the blood DNA<\/strong> with restriction endonucleases was carried out in test tubes for PCR (200 \u00b5l). In each test tube 13.5 \u00b5l of H2<\/sub>O and 1.5 \u00b5l of DNA with concentration about 18 ng\/\u00b5l were mixed. 2 tubes with DNA were prepared for each sample. 15.1 ml of restriction mixture was added to one tube. 15.1 ml of mixture A was added to the other tube in the case of analysis of DNA fragment 9-604, 15.1 ml of mixture B was added to the other tube in the case of analysis of DNA fragment 1-178, and 15.1 ml of mixture C was added to the other tube in the case of analysis of DNA fragments 17-027 or 11-215. For the DNA fragment 1-178, incubation was carried out at 60 C, in the other cases \u2013 at 37 C. The incubation time was 30 minutes.<\/p>\n

PCR<\/strong>. After incubation and a shot centrifugation to collect drops, 30.2 \u00b5l of PCR mixture was added to each tube. After mixing, the content of each test tube (60 ml) were dispensed (20 ml each) into the wells of a PCR plate for 96 wells.<\/p>\n

To calculate specific primers and probes<\/strong>, we used nucleotide sequences from the GenBank database (http:\/\/ncbi.nlm.nih.gov\/genbank) according to the version of the human genome GRCh38\/hg38, the set of programs \u201cVector NTI 11.5 \u201c(Invitrogen, USA) and the online resource \u201cBLAST\u201d (http:\/\/blast.ncbi.nlm.nih.gov). The structure of the primers and the fluorescently labeled probe used in the work is shown below:<\/p>\n

9-604z 5\u2032 FAM-TGTGAGCCACTGTGACCAGCCCCC-BHQ1 3\u2032(24)
\n9-604d 5\u2032 CCTCGGCCTCCCAGAGTGC 3\u2032(19)
\n9-604r 5\u2032 CCTGCTGCCATCTTTGGTTCC 3\u2032 (21)<\/p>\n

17-027z 5\u2032 TCAAAGGTCCCCAGCCCCCAA 3\u2032(21)
\n17-027r 5\u2032 CCAAGCCAGCCTCTGTCCCA 3\u2032(20)
\n17-027d 5\u2032 GGGGTGTGGCAGGCAGGAG 3\u2032(19)<\/p>\n

11-215z 5\u2032 CCACCGCCCGAGGGATGAAGACC 3\u2032(23)
\n11-215d 5\u2032 TGGTGCCCTCGGGTAAGCG 3\u2032(19)
\n11-215r 5\u2032 CCC AGG CCA CAC GGA ACT TTC 3\u2032(21)<\/p>\n

1-178z 5\u2032 CCGCCGTTCAGCAGCCGCCC 3\u2032(20)
\n1-178r 5\u2032 CGGCGGCAACATTGTTTGGT 3\u2032(20)
\n1-178d 5\u2032 GGC CCC TTC CAT TGT CAT TGC T 3\u2032(22)<\/p>\n

RT PCR was performed<\/strong> according to the manufacturer\u2019s Protocol [7] in a volume of 20 \u00b5l in the thermocycler CXF-96 (\u201cBio-Rad\u201d, USA) according to the following program:<\/p>\n

for fragments 9-604, 17-027, 1-178 :<\/p>\n